Trở về truyện

Vòng xoáy chết - Phần 2.7

Vòng xoáy chết

19 Phần 2.7

Ando ngó đầu vào văn phòng khoa Bệnh họ xem Miyashita có ở đó không, nhưng anh chưa kịp nói gì thì Miyashita đã gọi.

"A, đúng là người tôi đang cần gặp. Cậu nghĩ sao về cái này." Miyashita đang cầm một bản in, và dùng tay kia ra hiệu cho Ando. Bên cạnh anh ta là Nemoto, trợ lý phòng xét nghiệm hóa sinh. Nemoto và Miyashita có bề ngoài giống nhau đến mức bất cứ ai gặp họ ở gần nhau cũng không nén nổi bật cười. Từ chiều cao 1,62m, cân nặng chừng hơn 77kg - đến chiều dài chân, khổ người, khuôn mặt, thậm chí kiểu ăn mặc và giọng nói, họ giống nhau như hai hạt đậu trong cùng một quả đậu.

"Này, tôi không biết là cậu lại có người em sinh đôi đấy." Ando luôn thốt ra câu nói đùa ấy mỗi khi anh gặp họ.

"Bác sĩ Ando, anh đừng có đánh đồng tôi với ông này," Nemoto nhăn mặt nói. Nhưng không có gì là ghê gớm khi được nhận xét giống người đồng nghiệp lớn hơn anh ta hai tuổi. Dù gì, Miyashita cũng được yêu mến vì cả tính cách lẫn học vấn, lại còn được trao danh hiệu ứng cử viên tương lai cho hàm giáo sư.

"Mọi người bảo chúng ta giống nhau Nemoto ạ. Tôi cho cậu biết, chuyện này bắt đầu giống như cái nhọt ở mông vậy. Tại sao cậu không ăn kiêng đi nhỉ?" Miyashita huých vào bụng người đồng nghiệp trẻ.

"À, nếu tôi mà ăn kiêng, anh cũng phải ăn kiêng."

"Thế chúng ta lại quay về nơi bắt đầu à?"

Rồi Miyashita đưa cho Ando bản in mà anh ta đang cầm, như thể để chấm dứt tiết mục hài cũ mèm đó.

Ando giở bản in vừa nhận được ra. Nhìn qua anh cũng biết ngay nội dung là gì. Nó hiện kết quả chạy một đoạn ADN qua máy giải mã.

Tất cả mọi sinh vật sống trên trái đất đều có một hoặc nhiều tế bào chứa ADN (hoặc trong một số trường hợp là ARN). Nhân của những tế bào này chứa các hợp chất phân tử gọi là axit nuclêic. Có hai loại axit nuclêic: ADN (axit deoxyribonucleic) và ARN (axit ribonucleic). Chúng đóng các vai trò khác nhau. ADN là hợp chất có thông tin di truyền được chứa trong các nhiễm sắc thể: nó có dạng hai chuỗi xoắn vào nhau theo đường xoắn ốc, một cấu trúc gọi là chuỗi xoắn kép. Tổng hợp thông tin di truyền của một hình thái sống được ghi lại trong chuỗi xoắn kéo đó. Thông tin di truyền này giống như một bản thiết kế để xây những protein chuyên biệt; mỗi gen là một bản thiết kế. Nói cách khác, gen và ADN không phải là một. Mỗi gen là một đơn vị thông tin.

Vậy chính xác là cái gì được ghi trong bản thiết kế này? Các chữ cái tạo nên dãy ký tự là bốn hợp chất hóa học gọi là các bazơ: adenin (A), guanine (G), cytosin (C) và thymin (T), hoặc đối với ARN là uracil (C). Các bazơ này kết hợp theo từng nhóm bazơ gọi là codon, chuyển hóa thành các axit amin. Ví dụ, codon AAC tạo thành asparagin, codon GCA tạo thành alamin, v.v...

Có khoảng hai mươi loại axit amin, và protein là tổng hợp của hàng trăm phân tử axit amin này. Điều đó có nghĩa cấu tạo của một protein phải chứa một dãy các bazơ có số lượng bằng với số lượng của các phân tử amin nhân ba.

Do đó, cấu tạo của cái gọi là gen, về cơ bản có thể xem là một dãy dài gồm những ký tự, như thế này: TCTCTATACCAGTTGGAAAATTAT... Khi được dịch ra, nó nghĩa là một loạt các axit amin gồm: TCT (serin, hay Ser), CTA (leucin, hay Leu), TAC (tyrosin, Tyr), CAG (glutamine, Gln), TTG (leucin, Leu), GAA (axit glutamic, Glu), AAT (asparagin, Asn), TAT (tyrosin, Tyr) v.v... và v.v...

Ando nhìn lại các mã bazơ hiện lên trên bản in, bốn ký tự A, T, G, và C xếp thành dãy có vẻ ngẫu nhiên trên trang giấy. Có những đoạn ba dòng dược đánh dấu đề làm nổi bật lên so với phần còn lại.

"Cái gì thế này?"

Miyashita nháy mắt với Nemoto, như thế muốn nói, cậu nói đi.

"Đây là phân tích một đoạn AND lấy ra từ virus tìm thấy trong máu của Ryuji Takayama."

"Hiểu rồi... vậy đây là cái gì?"

"Chúng tôi phát hiện một chuỗi bazơ khá lạ, điều này chúng tôi chỉ thấy trong virus của Takayama."

"Và đó là cái được đánh dấu ở đây?"

"Đúng thế."

Ando nhìn kỹ hơn vào các dãy ký tự được đánh dấu đầu tiên.

ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA

Anh nhìn vào đoạn đánh dấu thứ hai, và so sánh với đoạn thứ nhất. Anh nhận ra chúng giống hệt nhau. Trong một nhóm chưa đến một nghìn bazơ, chính chuỗi này lặp lại hai lần.

.....................................................................................

.....................................................................................

480

..........................................................GTTTAAAGCA

490 500 510

TTTGAGGGGGATTCAATGAATATTTATGAC

520 530 540

GATTCCGCAGTATTGGACGCTATCATGGAA

550 560 570

GAAGAATATCGTTATATTCCTCCTCCTCAAC

580 590 600

AACAA TTTGCAAAAGCCTCTCGCTATTTTGG

610 620 630

TTTTTATCGTCTGGTAAACGAGGGTTTATGA

640 650 660

TAGTTTGCTCTTACTATGCCTCGTAATTCCTT

670 680 690

TTGGCGTTATGTATCTGCATTAGTTGAATGTG

700 710 720

GGTATTCCTAAATCTCAACTGATGAATCTTTT

730 740 750 760

TTTCTACCTGTAATAATGTTGTTCCGTTAGTT

770 780 790

CGATTAACGTAGATTTTTCTTCCCAACGTCCT

800 810 820

GACTGGGATTTCGACACAAATGGAAGAAGAA

830 840 850

TATCGTTATATTCCTCCTCCTCAACAACAA CG

860 870 880

CTTGGTATAATCGCTGGGGGTCAAAGATGAG

890 900

TGTTTTTAGTATATT.............................................

Ở trên: giữa 535 và 576, rồi lặp lại giữa 815 và 856, có thể nhìn lấy sự lặp lại 42 bazơ ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA.

BẲNG DIỄN GIẲI CÁC ADN AXIT AMIN

Các bộ ba bazơ (codon) được phiên dịch thành các axit amin theo nguyên tắc nêu trong bảng trên. Ví dụ, TCT là Serin (Ser), AAT là asparagin (Asn), GGA là axit glutamic (Glu). "Stop" để chỉ kết thúc một gen; mã khởi đầu là ATG.

Dưới đây là tên viết tắt và tên đầy đủ của hai mươi axitamin:

Phe phenylalanine His histidin

Leu leucin Gln glutamin

Ile isoleucin Asn asparagin

Met methionin Lys lysin

Val valin Asp axit asparatic

Ser serin Glu axit glutamic

Pro prolin Cys cystein

Thr threonin Trp tryptophan

Ala alanin Arg arginin

Tyr tyrosin Gly glycin

Ando rời mắt khỏi bản in, nhìn sang Nemoto.

"Cho dù có cắt nó ra ở đâu, thì chúng ta luôn thấy các chuỗi này."

"Trong chuỗi này có bao nhiêu?"

"Ý anh là bao nhiêu bazơ?"

"Ừ."

"Bốn hai."

"Bốn hai. Vậy là mườn bốn codon, đúng không? Không nhiều lắm."

"Chúng tôi nghĩ nó có ý nghĩa gì đó," Nemoto lắc đầu nói. "Nhưng, bác sĩ Ando này, điều kỳ lạ là..."

Miyashita xen vào. "Sự lặp lại vô nghĩa này chỉ thấy trong virus được lấy từ mẫu máu của Ryuji, còn những nạn nhân khác thì không có." Anh ta giơ hai tay làm điệu bộ bối rối.

Nói cách khác ... Ando cố tìm ra sự so sánh tương đương. Giả sử, có ba người, trong đó có một người là Ryuji, có các bản kịch Vua Lear của Shakespeare. Giả sử tiếp rằng bản của Ryuji, và chỉ riêng bản của anh ta thôi, có một chuỗi vô nghĩa các chữ cái được xen vào giữa các dòng. Chỉ có bốn hai bazơ, và chúng được kết hợp theo từng bộ ba bazơ, mỗi bộ tương ứng với một axit amin.Nếu gán cho mỗi bộ này một ký tự, ta sẽ có một chuỗi mười bốn ký tự. Và mười bốn ký tự trùng lặp này xuất hiện trên từng trang của vở kịch, được xen vào một cách ngẫu nhiên. Nếu từ đầu ta biết đó là vở kịch Vua Lear, thì tất nhiên có thể quay lại và tìm thấy những phần vô nghĩa đã được thêm vào đó rồi đánh dấu chúng.

"Thế cậu nghĩ sao?" Myashita có vẻ thực sự quan tâm đến ý kiến của Ando. Là một nhà khoa học chân chính, anh ta luôn rất phấn khích khi đối mặt với những điều không thể giải thích được.

"Tôi nghĩ sao à? Tôi cần phải tìm hiểu thêm trước khi có thể nói được điều gì."

Ba người đều im lặng, người này nhìn người kia. Ando thấy lung túng, tay vẫn cầm bản in.

Có điều gì nảy ra trong ý thức của anh. Để xác định đó là gì, anh cần thời gian ngẫm nghĩ và tìm hiểu chuỗi bazơ vô nghĩa đó. Anh linh cảm rõ ràng rằng có gì đó ở đây. Nhưng vấn đề là gì? Và nếu chuỗi bazơ vô nghĩa này thực sự được chèn vào, thì nó xảy ra lúc nào? Có phải virus xâm nhập vào cơ thể Ryuji là một loại virus khác? Hay nó đã đột biến trong cơ thể Ryuji, và dãy gồm mười bốn codon xuất hiện nhiều lần là kết quả của sự đột biến đó? Điều đó có thể xảy ra không? Và nếu có, nó nghĩa là gì?

Sự yên lặng đè nặng lên ba người. Không chút suy đoán nào vào lúc này tiết lộ cho họ biết làm sao giải thích được những phát hiện đó.

Myashita là người phá vỡ sự im lặng. "Nhân tiện, cậu đến đây có việc gì à?"

Ando bị phát hiện này hấp dẫn quá đến mức quên cả mục đích ban đầu của cuộc viếng thăm. "Đúng rồi, tôi quên mất." Anh mở cặp, lấy sổ ghi chép ra, đưa cho Myashita và Nemoto một mẩu giấy.

"Không biết có ai ở đây có máy xử lý văn bản model này không?"

Myashita và Nemoto nhìn tên model máy viết trên mẫu giấy. Đó là loại máy khá thông dụng.

"Có nhất thiết chính xác model này không?"

"Chỉ cần cùng một hãng sản xuất là được, model có lẽ không quan trọng. Đây chẳng qua là chuyện có tương thích với một chiếc đĩa mềm không thôi."

"Tương thích?"

"Đúng." Ando lấy trong cặp ra một chiếc đĩa mềm.

"Tôi cần in ra một bản và copy một bản những file trong đĩa này."

"Tôi cho là nó không được lưu trong MS-DOS, đúng không?"

"Tôi không nghĩ thế."

Nemoto vỗ tay, như thể vừa nhớ ra điều gì đó.

"A, một người trong khoa tôi, chắc là Ueda, có chiếc máy đúng model này."

"Anh nghĩ liệu anh ta có cho tôi mượn nó không?" Ando ngần ngại. Anh chưa bao giờ gặp người tên Ueda này cả.

"Tôi không nghĩ có khó khăn gì, anh ta là lính mới." Nemoto nói với vẻ tự tin của một người kỳ cựu trong khoa, biết rõ rằng lính mới sẽ làm bất cứ điều gì mình đề nghị.

"Cảm ơn."

"Không sao. Tại sao chúng ta không ta không đến đó ngay bây giờ? Tôi nghĩ anh ta đang ở đó."

Đây đúng là tiếng nhạc rót vào tai Ando. Anh nóng lòng muốn in nội dung có trong chiếc đĩa này, cho dù đó là cái gì.

"Tuyệt lắm. Đi thôi." Ando bỏ chiếc đĩa vào túi áo jacket. Rồi vẫy tay chào Myashita, anh đi theo Nemoto đến khoa Bệnh học.

TruyenC

Copyright © 2021 TruyenC.